control scrambled sgrna crispr lenti vector (Addgene inc)
Addgene inc is a verified supplier 
95
Structured Review
Addgene inc
control scrambled sgrna crispr lenti vector
Control Scrambled Sgrna Crispr Lenti Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 118 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+scrambled+sgrna+crispr+lenti+vector/pKLV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W+(Plasmid+%2367974)/pmc11347225__gutjnl___2023___330995supp001-208-74-79
Average 95 stars, based on 118 article reviews
Control Scrambled Sgrna Crispr Lenti Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 118 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+scrambled+sgrna+crispr+lenti+vector/pKLV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W+(Plasmid+%2367974)/pmc11347225__gutjnl___2023___330995supp001-208-74-79
Average 95 stars, based on 118 article reviews
control scrambled sgrna crispr lenti vector - by Bioz Stars,
2026-09
95/100 stars
Images
Related Articles
Plasmid Preparation:Article Title: The Peptidoglycan Recognition Protein 1 confers immune evasive properties on pancreatic cancer stem cells Article Snippet: Lentiviral particles were produced by transfection of 293T cells (Invitrogen) following a polyethylenimine (PEI)-based protocol, as previously described (15). .. Briefly, 8.5 × 105 293T cells were co-transfected with 1 μg packaging plasmid psPAX2, 1 μg envelope plasmid pVSVG and 2 μg of the indicated backbone plasmid: pRRL-CMV-IRES-mCherry, pReceiver-Lv106_PGLYRP1 (murine PGLYRP1, 217EX-Mm05789-Lv206, GeneCopoeia), pReceiver-Lv106_PGLYRP1 (human PGLYRP1, 217EX-U0257-Lv206, GeneCopoeia), pCAS9 or 5 different PGLYRP1-CRISPR plasmids (Target sequences: For murine PGLYRP1 were CATGACCGTCCTCTCCAATA, AGGCGGCTAGAGCACTCGGA and ATGTCTATGAAGGCCGAGGC; for human PGLYRP1 were GATACCACCACATAGCGTAA and GAAGACGGGCTCGTATACGA; and they were cloned into pKLV2-U gRNA5(BbsI)-PGKpuro2ABFP-W backbone vector from Addgene (#67974)) or Clone Assay:Article Title: The Peptidoglycan Recognition Protein 1 confers immune evasive properties on pancreatic cancer stem cells Article Snippet: Lentiviral particles were produced by transfection of 293T cells (Invitrogen) following a polyethylenimine (PEI)-based protocol, as previously described (15). .. Briefly, 8.5 × 105 293T cells were co-transfected with 1 μg packaging plasmid psPAX2, 1 μg envelope plasmid pVSVG and 2 μg of the indicated backbone plasmid: pRRL-CMV-IRES-mCherry, pReceiver-Lv106_PGLYRP1 (murine PGLYRP1, 217EX-Mm05789-Lv206, GeneCopoeia), pReceiver-Lv106_PGLYRP1 (human PGLYRP1, 217EX-U0257-Lv206, GeneCopoeia), pCAS9 or 5 different PGLYRP1-CRISPR plasmids (Target sequences: For murine PGLYRP1 were CATGACCGTCCTCTCCAATA, AGGCGGCTAGAGCACTCGGA and ATGTCTATGAAGGCCGAGGC; for human PGLYRP1 were GATACCACCACATAGCGTAA and GAAGACGGGCTCGTATACGA; and they were cloned into pKLV2-U gRNA5(BbsI)-PGKpuro2ABFP-W backbone vector from Addgene (#67974)) or Control:Article Title: The Peptidoglycan Recognition Protein 1 confers immune evasive properties on pancreatic cancer stem cells Article Snippet: Lentiviral particles were produced by transfection of 293T cells (Invitrogen) following a polyethylenimine (PEI)-based protocol, as previously described (15). .. Briefly, 8.5 × 105 293T cells were co-transfected with 1 μg packaging plasmid psPAX2, 1 μg envelope plasmid pVSVG and 2 μg of the indicated backbone plasmid: pRRL-CMV-IRES-mCherry, pReceiver-Lv106_PGLYRP1 (murine PGLYRP1, 217EX-Mm05789-Lv206, GeneCopoeia), pReceiver-Lv106_PGLYRP1 (human PGLYRP1, 217EX-U0257-Lv206, GeneCopoeia), pCAS9 or 5 different PGLYRP1-CRISPR plasmids (Target sequences: For murine PGLYRP1 were CATGACCGTCCTCTCCAATA, AGGCGGCTAGAGCACTCGGA and ATGTCTATGAAGGCCGAGGC; for human PGLYRP1 were GATACCACCACATAGCGTAA and GAAGACGGGCTCGTATACGA; and they were cloned into pKLV2-U gRNA5(BbsI)-PGKpuro2ABFP-W backbone vector from Addgene (#67974)) or CRISPR:Article Title: The Peptidoglycan Recognition Protein 1 confers immune evasive properties on pancreatic cancer stem cells Article Snippet: Lentiviral particles were produced by transfection of 293T cells (Invitrogen) following a polyethylenimine (PEI)-based protocol, as previously described (15). .. Briefly, 8.5 × 105 293T cells were co-transfected with 1 μg packaging plasmid psPAX2, 1 μg envelope plasmid pVSVG and 2 μg of the indicated backbone plasmid: pRRL-CMV-IRES-mCherry, pReceiver-Lv106_PGLYRP1 (murine PGLYRP1, 217EX-Mm05789-Lv206, GeneCopoeia), pReceiver-Lv106_PGLYRP1 (human PGLYRP1, 217EX-U0257-Lv206, GeneCopoeia), pCAS9 or 5 different PGLYRP1-CRISPR plasmids (Target sequences: For murine PGLYRP1 were CATGACCGTCCTCTCCAATA, AGGCGGCTAGAGCACTCGGA and ATGTCTATGAAGGCCGAGGC; for human PGLYRP1 were GATACCACCACATAGCGTAA and GAAGACGGGCTCGTATACGA; and they were cloned into pKLV2-U gRNA5(BbsI)-PGKpuro2ABFP-W backbone vector from Addgene (#67974)) or |